# Count ## Quantify barcoded strains in a sample with `mbarq count` ### Input/Output files **Required Inputs** - Sample sequencing file. Can be FASTQ of FASTA, compressed is accepted. - Transposon construct structure **Sugested Inputs** - Mapping file. Can be the mapping file produced by ``mbarq map``, or any ``csv`` file, where the first column is titled ``barcode`` and contains the barcode sequences. - For example: | barcode | barcodeID | |---------|-----------| | ATGCATG | Barcode1 | - By default, will try to merge barcodes with edit distance of <= 2. This can be changed with ``-e``. **Output Files** ### Example Usage ```bash mbarq count -f -m \ -n ExperimentName -tn B17N13GTGTATAAGAGACAG ``` ### All Options ``` Usage: mbarq count Options: -f, --forward FILE input file for reads in forward orientation; FASTQ formatted; gz is ok. [required] -m, --mapping_file FILE Mapping file produced by `mbarq map`. Alternatively, will accept any csv file, where the first column is titled "barcode", and contains the barcode sequences. Example: barcode,barcodeID AGACCAGTACATGACGGGTATCTCTCTGCCACTCCTGTAT,Tag_1 [optional] -o, --out_dir DIR output directory [.] -n, --name STR unique library name, by default will try to use FASTQ filename -tn, --transposon STR transposon construct structure, consisting of the following: 1. barcode length, written as B[# of nt], eg. B17 2. conserved sequence motif, usually part of transposons inverted repeat (IR), eg. GTGTATAAGAGACAG 3. if there are extra nucleotides between barcode and conserved sequence motif, indicate with N[# of nt], eg. N13 The default represents the following construct: ---------------------------------------------------------------------------- Read ||AGTACTTTACTACTACT||TACCTGACCGTAA||GTGTATAAGAGACAG||TTACCTGACCGAC ----------||-----------------||-------------||---------------||------------- Components|| barcode || spacer || conserved || host || || || motif (IR) || ----------||-----------------||-------------||---------------||------------- Encoding || B17 || N13 ||GTGTATAAGAGACAG|| ---------------------------------------------------------------------------- Note: relative position of barcode and conserved sequence motif matters, i.e. if conserved sequence motif comes before the barcode, it should be written as GTGTATAAGAGACAGN13B17. For WISH data, use GGAGGTTCACAATGTGGGAGGTCAB40 [B17N13GTGTATAAGAGACAG] -e, --edit_distance INT merge barcodes with edit distances <= [INT] [2] -h, --help Show this message and exit. ``` ## Merge: merge count files from multiple samples with `mbarq merge` ### Input/Output Files **Required Inputs** - **EITHER** a comma-separated list of count files to be merged **OR** a path to the directory containing all the count files to be merged. - Prefix for the output file. **Suggested Inputs** - If you would like to keep one of the annotation (attribute) columns from the mapping file, it can be specified with `-a` option. Include this option, if you plan to run `mbarq analyze`. **Output file** - `csv` file, where columns are barcodes, attribute if specified, and one column containing counts for each sample. ### Example Usage ```bash mbarq merge -d -a locus_tag -n ExperimentName -o . ``` ### All Options ``` Usage: mbarq merge Options: -i, --input_files FILE[,FILE] list of mBARq count files to merge (comma separated) -d, --count_dir DIR merge all files in the directory -o, --out_dir DIR output directory -n, --name STR output file prefix -a, --attribute STR Feature attribute to keep in the merged file (ex. ID, Name, locus_tag) -h, --help Show this message and exit. ```